 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circular RNA SCD-circRNA 2 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
| DBLink | PMID | 31235426 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | HCC and para-carcinoma tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCTGCTTACTTGGTGAGGGTG ReverseAGATGTTTCTGGGAGGGTTTG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Dong, W, Dai, ZH, Liu, FC, Guo, XG, Ge, CM, Ding, J, Liu, H, Yang, F (2019). The RNA-binding protein RBM3 promotes cell proliferation in hepatocellular carcinoma by regulating circular RNA SCD-circRNA 2 production. EBioMedicine, 45:155-167. | |||